SEAsnake is a snakemake pipeline to process bulk RNA-seq data from fastq sequences to gene counts. It includes the following steps. You can see an in-depth example of how to run these steps separately outside SEAsnake in our first tutorial.
view
flagstat and/or
Picard
CollectRnaSeqMetricsfeatureCounts
Here, we provide an example of how to install and run SEAsnake on human bulk RNA-seq.
CPU (aka cores): Many of the steps in SEAsnake run in parallel. Thus, the time to run the pipeline on 2 CPUs is roughly half of 1 CPU (not counting non-parallel processes like genome indexing). Thus, you could run as many CPUs as you have fastq files. However, this may not always be recommended as there is a trade-off with RAM usage.
RAM: Estimating RAM usage is difficult. The most impactful values to consider are number of CPUs, fastq file size, and reference genome size. Each CPU uses equivalent RAM for parallel jobs. So 2 CPUs require twice the RAM as 1 CPU. Sample and genome size also contribute as larger files use more RAM on each CPU being run. The most common pipeline failure is running out of RAM, so when in doubt, choose the larger option.
Our recommendation: We follow a general rule of CPU
= fastqs / 3 and RAM = CPU * 3 + 40 where each CPU gets 3 GB of RAM and
there is an additional 40 GB for the genome. If your fastq are large
(> 5 GB), you may need to increase the CPU factor for RAM
calculation. For us, the exact number of CPUs depends on what is
available on AWS, and these parameters are commonly met by
m5 instance types.
Note that indexing the human genome requires a minimum of 40 GB of RAM, so do not go below this if you need to complete that step.
Storage: SEAsnake itself is a small program (< 150 MB). Thus, storage needs depend almost entirely on your sample size and sequencing depth of those samples. Larger raw fastq result in larger result files.
Our recommendation: We recommend 25 GB per 1 fastq
file plus 100 GB for the genome. This comes to roughly 1 TB for 36 fastq
or 18 paired-end samples. If you are using aws sync to load
fastq and/or reference files, these do not contribute to the storage
load and can be subtracted from your estimate. Again values may need to
be scaled up if your original fastq tend to be larger than 5 GB.
SEAsnake step 1 completes 1 fastq in 30 to 45 min. Since this step is run in parallel, your estimated completion time is equal to the number of fastq / CPU run in parallel * 0.75 hours. For example using our recommended compute size, if you have 40 fastq and run on 40 / 3 = 14 cores, this is 40 / 14 * 0.75 = 2.1 hours.
SEAsnake step 2 completes 1 set of paired end fastq in roughly 10 hours. Using the same example, if you have 40 fastq from 20 paired end samples running on 14 cores, this is 20 / 14 * 10 = 14.3 hours. Non-paired end samples takes about half the time.
Step 2 will take less time if you do not have adapter contamination
requiring alignment in AdapterRemoval (- 1 hour per single
fastq or paired-end sample) or if you already have an indexed reference
genome for STAR (- 1 hour from total time).
We are working on improving speed so please check for updates periodically.
SEAsnake can be pre-installed on any AWS EC2 instance.
Make sure your in the us-west-2 (Oregon) region as noted in the upper right of the screen. Otherwise, you will not see the SEAsnake AMI.
r5a.2xlarge because the sample fastq
are very small. For full datasets, m5 types is our most
used instance class.
3. Create or find a key pair you can access.
Once the instance is running, log-in. Please replace the key and IP address with data for your instance.
ssh -i PATH_TO_KEY.pem ec2-user@Public_IPv4_DNS.com
Then, complete setup as follows. First, define your AWS account
information. Note that your AWS_REGION should be just the
base region like us-west-2 without any sub-letters.
AWS_ACCESS_KEY="XXXX"
AWS_SECRET_ACCESS_KEY="XXXX"
AWS_REGION="us-west-2"
Then, run the following script which will configure your AWS account.
#### Basic AWS update ####
sudo yum upgrade -y
sudo yum update -y
#### Configure AWS ####
## Configure your account
export AWS_ACCESS_KEY_ID=$AWS_ACCESS_KEY
export AWS_SECRET_ACCESS_KEY=$AWS_SECRET_ACCESS_KEY
export AWS_DEFAULT_REGION=$AWS_REGION
## Setup fuse keys
echo $AWS_ACCESS_KEY:$AWS_SECRET_ACCESS_KEY > ~/.passwd-s3fs
chmod 600 ~/.passwd-s3fs
Next, get your EBS volume name. On most setups, this next code chunk
will automatically result in the correct ebs_name. However,
double-check the output to make sure the echo command
results in the volume you want from the lsblk list. The
correct one is the large one you intend to store all results on.
#### Setup EBS volume ####
## Get addtl volume name
lsblk
ebs_name=$(lsblk -o NAME -n -i | tail -n 1)
echo $ebs_name
If this does not give the correct volume name, find it with
lsblk and input the name by-hand.
lsblk
ebs_name="XXXX"
Finally, format the additional EBS volume and install SEAsnake.
## Format volume
sudo mkfs -t ext4 /dev/$ebs_name
## Attach SEAsnake directory to volume
sudo mkdir -p ~/SEAsnake
sudo mount /dev/$ebs_name ~/SEAsnake
## Change permissions to read-write
sudo chmod 777 -R ~/SEAsnake/
## Remove default subdir
sudo rm -R ~/SEAsnake/lost+found
## Clone SEAsnake from GitHub
git clone https://github.com/BIGslu/SEAsnake ~/SEAsnake
If you are not using AWS, you can install SEAsnake and its dependencies using the following scripts.
#### Install conda ####
## Download conda
sudo mkdir -m 777 -p ~/apps/anaconda
cd ~/apps/anaconda
sudo curl -O https://repo.anaconda.com/archive/Anaconda3-2021.11-Linux-x86_64.sh
## Compile and install conda
sudo bash Anaconda3-2021.11-Linux-x86_64.sh -b -p /home/ec2-user/apps/anaconda -u
eval "$(/home/ec2-user/apps/anaconda/bin/conda shell.bash hook)"
conda init
sudo chmod 777 -R ~/apps/
Restart your terminal for conda initiation to take effect.
## Configure addtl conda channels
conda config --add channels bioconda
conda config --add channels conda-forge
conda config --set allow_conda_downgrades true
#### Install mamba ####
conda install -n base -c conda-forge mamba -y --repodata-fn repodata.json
#### Install SEAsnake ####
## Install git
sudo yum install git -y
## Clone SEAsnake from GitHub
sudo mkdir -m 777 ~/SEAsnake
git clone https://github.com/BIGslu/SEAsnake ~/SEAsnake
## Create environment and install SEAsnake software with mamba
mamba env create --name SEAsnake --file ~/SEAsnake/environment/Hissss_env.yaml
If you previously installed SEAsnake, you can update it by pulling the latest version from GitHub.
cd ~/SEAsnake
git pull
Note: SEAsnake is only setup to run paired-end
fastq.qz files in its data/
directory.
If you are using fuse to access your fastq data on S3, link your
bucket to the SEAsnake data/ directory. Note that your
DATA_BUCKET name must not contain . or
else fuse will not work.
# Define the name of your data bucket
DATA_BUCKET="MY_BUCKET_NAME"
# Make directory for data
sudo mkdir -m 777 ~/SEAsnake/data
# Fuse bucket to directory
s3fs $DATA_BUCKET ~/SEAsnake/data \
-o passwd_file=~/.passwd-s3fs \
-o default_acl=public-read -o uid=1000 -o gid=1000 -o umask=0007
If you are transferring data by another method, create the
SEAsnake/data/ directory and copy your data there. For
example, to run this vignette’s example data.
# Make directory for data
sudo mkdir -m 777 ~/SEAsnake/data
# Copy fastqs
cp ~/SEAsnake/vignette/data/*fastq.gz ~/SEAsnake/data
SEAsnake looks for specific filenames in the data/
directory based on default Illumina outputs. Your files must follow
these rules for SEAsnake to run correctly.
All files:
fastq.gz formatPaired-end files:
_R1 and
_R2 in the filename
_R1 or
_R2 including sample names_L###. Everything before this lane number is treated as the
sample nameFor example, test_S1_L005_R1_001.fastq.gz is sample
test_S1
If you have multiple files per sample, use the following code to
concatenate to 1 file per read per sample. This assumes 1) all files for
a single sample are in a single subdirectory named by sample name, and
2) you fused a bucket with your data; thus, you need to initially save
the concatenated data to a new directory data2/ since
data/ is read-only.
Paired-end data
cd ~/SEAsnake
mkdir -p data2
for d in ./data/* ; do
cd "$d"
echo "$d"
cat *_R1*.fastq.gz > ../../data2/"$d"_L000_R1_concat.fastq.gz
cat *_R2*.fastq.gz > ../../data2/"$d"_L000_R2_concat.fastq.gz
cd ..
done
#Unmount original data and move concatenated files to data/
cd ~/SEAsnake
fusermount -u data
mv data2/* data/
Single read data
cd ~/SEAsnake
mkdir -p data2
for d in ./data/* ; do
cd "$d"
echo "$d"
cat *.fastq.gz > ../../data2/"$d".fastq.gz
cd ..
done
#Unmount original data and move concatenated files to data/
cd ~/SEAsnake
fusermount -u data
mv data2/* data/
If you are using fuse to access your STAR-formatted genome index on
S3, link your bucket to the SEAsnake ref/ directory.
Hawn/Altman labs: These are in the bucket
human-ref.
# Define the name of your data bucket
REF_BUCKET="MY_BUCKET_NAME"
# Make directory for data
sudo mkdir -m 777 ~/SEAsnake/ref
# Fuse bucket to directory
s3fs $REF_BUCKET ~/SEAsnake/ref \
-o passwd_file=~/.passwd-s3fs \
-o default_acl=public-read -o uid=1000 -o gid=1000 -o umask=0007
If you do not have a pre-built index, the pipeline will make one for you!
Set the number of cores you would like to use. This should be no more than your total CPU - 1. Then, activate the conda environment, which contains all pre-installed software, and move into the SEAsnake directory.
cores=15
conda activate SEAsnake
cd ~/SEAsnake
Next, run SEAsnake step 1. This completes initial sequence quality
assessment, directory structure setup, and config file creation.
Note that nohup and piping into a log file means
nothing will appear in your terminal window. This prevents timeout and
retains all messages and errors in the log file.
nohup snakemake --snakefile Snakefile_step1 --cores $cores >> log/SEAsnake_step1.log 2>&1 &
Your directory structure will look like
snakemake commandFor those less familiar with bash scripting, here is a detailed break
down of the command used to run SEAsnake in snakemake
nohup tells the program to continue running even if you
log out or close your terminal windowsnakemake --snakefile Snakefile_step1 runs the step1
SEAsnake commands in the snakemake program--cores $cores distributes the process across the
number of cores you specify>> log/SEAsnake_step1.log 2>&1 saves all
standard output and errors (what’s normally printed in the terminal
window as something runs) to the log file instead& pushed to process to the background so you can
immediately start using other commands (like checking progress below) in
the same terminal windowIf you want to check progress, you can see what is currently running in the log.
tail ~/SEAsnake/log/SEAsnake_step1.log
Or ask SEAsnake to summarize how many tasks need to still be
completed. The -n flag is a “dry run” where SEAsnake does
not actually run anything. In addition, --rerun-incomplete
causes SEAsnake to count processes that are not yet complete.
cd ~/SEAsnake
conda activate SEAsnake
snakemake --snakefile ~/SEAsnake/Snakefile_step1 -n --rerun-incomplete
You’ll see something like this. This example shows that 2 of the fastq files still need to complete FastQC.
Job stats:
job count min threads max threads
---------- ------- ------------- -------------
all 1 1 1
fastqc_raw 2 1 1
total 3 1 1
This was a dry-run (flag -n). The order of jobs does not reflect the order of execution.
Note that if your terminal times out, your job is still running! This
is why we use nohup. To check on the progress, simply log
back into the instance with ssh, cd into the
SEAsnake directory, and activate the conda environment again. Then run
one of the following options described above.
Save the results to an AWS bucket. We recommend using a different bucket than your DATA_BUCKET to retain the integrity of the raw data.
RESULT_BUCKET="MY_RESULT_BUCKET"
cd ~/SEAsnake
aws s3 sync result s3://$RESULT_BUCKET
Then download results from AWS to your local computer for review. This examples saves to your desktop
RESULT_BUCKET="MY_BUCKET_NAME2"
mkdir -p ~/Desktop/SEAsnake_result
cd ~/Desktop/SEAsnake_result
aws s3 sync s3://$RESULT_BUCKET/qc/ .
Step 1 creates result/config.yaml which allows some
customization of the workflow. Below is an example from the vignette
data with all defaults.
SampleList:
test_S1:
sample: 'test_S1'
R1: 'data/test_S1_L005_R1_001.fastq.gz'
R2: 'data/test_S1_L005_R2_001.fastq.gz'
test_S2:
sample: 'test_S2'
R1: 'data/test_S2_L005_R1_001.fastq.gz'
R2: 'data/test_S2_L005_R2_001.fastq.gz'
# Adapter removal
## Base pairs to trim from 5' end
trim5p: 10
## Removal of 3' adapter sequences? Default are Illumina Universal adapters
trimAdapt: True
adapter1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
adapter2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
# Genome alignment
## Species the format 'Homo_sapiens.GRCh38' or 'Mus_musculus.GRCm39'
genome: 'Homo_sapiens.GRCh38'
## Genome release number. Current as of 2022.04.14
release: '106'
# Alignment metrics
## Run Picard?
picard: True
# Other
threads: 15
You may wish to change some defaults.
fastq.gz from the data/
directory and will run the pipeline for all of these samples. To remove
a sample, simply remove the 4 lines relevant to that sample. To rename
result files for a sample, change the “sample” field.trim5p: Number of base pairs to trim from the 5’ end.
You determine this from FastQC “Per base sequence content”. For example,
this sample appears to have disproportionately high calls up to 10 bp.
This supports trimming the first 10 bp of these sequences
(default).trimAdapt: Sequencing adapters may also exist in the
data. These can be seen in FastQC “Adapter content” (below). You remove
these by aligning to adapter sequences provided in the config file.
Default are Illumina Universal adapters but you can provide any adapter
sequence.picard: This program provides additional alignment
quality metrics listed here.
If you do not need these metrics, set to False.threads
--cores parameter which sets the
maximum number of cores to run jobs in parallel. Thus, the total cores
being used is threads * cores.You can also find a more thorough introduction to quality assessment in our first tutorial.
Run SEAsnake step 2. This completes adapter trimming, alignment, filtering, quality assessment, and exon counting.
nohup snakemake --snakefile Snakefile_step2 --cores $cores >> log/SEAsnake_step2.log 2>&1 &
This step can take quite some time to run. Because of
nohup, you can close the terminal at any time and SEAsnake
will continue to run. Check in on progress in a new terminal window
using the log or -n --rerun-incomplete flags as you did for
step 1.
For example, a log
tail ~/SEAsnake/log/SEAsnake_step2.log
or SEAsnake dry run
conda activate SEAsnake
snakemake --snakefile ~/SEAsnake/Snakefile_step2 -n --rerun-incomplete
Job stats:
job count min threads max threads
-------------- ------- ------------- -------------
STAR_align 2 3 3
STAR_index 1 3 3
STAR_load 1 3 3
STAR_remove 1 1 1
adapterremoval 2 1 1
align_filter 2 1 1
all 1 1 1
combine 1 1 1
fastqc_trim 4 1 1
fcount 2 1 1
flagstat 2 1 1
picard 2 1 1
total 21 1 3
This was a dry-run (flag -n). The order of jobs does not reflect the order of execution.
Once complete, save your result/ and log/
directories because these will be lost once your stop your EC2 instance.
We recommend using aws s3 sync to save to an S3 bucket like
so.
RESULT_BUCKET="MY_RESULT_BUCKET"
aws s3 sync ~/SEAsnake/result/ s3://$RESULT_BUCKET
aws s3 sync ~/SEAsnake/log/ s3://$RESULT_BUCKET
If you want your raw counts first, use the following before copying everything else with the previous code.
RESULT_BUCKET="MY_RESULT_BUCKET"
aws s3 sync ~/SEAsnake/result/5_combined/ s3://$RESULT_BUCKET/5_combined/
You may also wish to save your genome index for use in future runs.
This saves about an hour of run time for human samples! Hawn/Altman
labs: Save to the human-ref bucket.
aws s3 sync ~/SEAsnake/ref/* s3://human-ref
Then, close the conda environment.
conda deactivate
And un-fuse any buckets in use.
fusermount -u ~/SEAsnake/data
fusermount -u ~/SEAsnake/ref
You main results will be in result/5_combined/ where all
samples have been combined into a single table per data type.
Counts table.
## # A tibble: 6 × 3
## Geneid test_S2 test_S1
## <chr> <dbl> <dbl>
## 1 ENSG00000171621 0 1
## 2 ENSG00000227372 1 1
## 3 ENSG00000074800 2 6
## 4 ENSG00000116786 0 1
## 5 ENSG00000049245 1 1
## 6 ENSG00000171729 1 1
Flagstat alignment metrics.
## # A tibble: 2 × 17
## libID QC_pass primary secondary supplementary duplicate primary_duplicate
## <chr> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl>
## 1 test_S2 5980 5980 0 0 0 0
## 2 test_S1 11990 11990 0 0 0 0
## # ℹ 10 more variables: mapped <dbl>, primary_mapped <dbl>, paired <dbl>,
## # read1 <dbl>, read2 <dbl>, paired_proper <dbl>, paired_mapped <dbl>,
## # singleton <dbl>, paired_diff_chr <dbl>, paired_diff_chr5 <dbl>
Picard alignment metrics.
## # A tibble: 2 × 31
## libID PF_BASES PF_ALIGNED_BASES RIBOSOMAL_BASES CODING_BASES UTR_BASES
## <chr> <dbl> <dbl> <lgl> <dbl> <dbl>
## 1 test_S2 825848 816841 NA 392505 246977
## 2 test_S1 1656408 1638802 NA 797841 490355
## # ℹ 25 more variables: INTRONIC_BASES <dbl>, INTERGENIC_BASES <dbl>,
## # IGNORED_READS <dbl>, CORRECT_STRAND_READS <dbl>,
## # INCORRECT_STRAND_READS <dbl>, NUM_R1_TRANSCRIPT_STRAND_READS <dbl>,
## # NUM_R2_TRANSCRIPT_STRAND_READS <dbl>, NUM_UNEXPLAINED_READS <dbl>,
## # PCT_R1_TRANSCRIPT_STRAND_READS <dbl>, PCT_R2_TRANSCRIPT_STRAND_READS <dbl>,
## # PCT_RIBOSOMAL_BASES <lgl>, PCT_CODING_BASES <dbl>, PCT_UTR_BASES <dbl>,
## # PCT_INTRONIC_BASES <dbl>, PCT_INTERGENIC_BASES <dbl>, …
Genome indexing with STAR requires both a lot of RAM (40 GB) and
storage (100 GB) for the human genome. If this step fails, check that
you have enough storage with df -h and if not, follow the
instructions below to add an EBS volume. If you do have enough storage,
then it was likely a RAM issue. Decrease the RAM used for indexing by
decreasing the thread option in the config file. Also,
delete the log file from indexing
(log/benchmark/STAR_index.benchmark.txt) or else SEAsnake
won’t know to rerun this step. Then, re-run the failed call with the
addition of --rerun-incomplete to fix any files that were
currently running when it crashed. For example,
## Remove log
rm log/benchmark/STAR_index.benchmark.txt
## Rerun SEAsnake
nohup snakemake --snakefile Snakefile_step2 --cores $cores --rerun-incomplete >> log/SEAsnake_step2.log 2>&1
You can see how much space is available on your instance with
df -h. When there is no more writable space in the SEAsnake
directory, you’ll see errors in the log such as
No space left on device. Since snakemake workflows decide
on what to run based on the outputs already present, you need to
add/create a larger volume, copy your ENTIRE SEAsnake directory to it,
and re-run the failed call with the addition of
--rerun-incomplete to fix any files that were currently
running when it crashed. For example,
## Input volume name. Can be found with lsblk
ebs_name2="NEW_VOLUME_NAME"
## Format volume
sudo mkfs -t ext4 /dev/$ebs_name2
## Attach SEAsnake directory to volume
sudo mkdir -p ~/SEAsnake2
sudo mount /dev/$ebs_name2 ~/SEAsnake2
## Change permissions to read-write
sudo chmod 777 -R ~/SEAsnake2/
## Remove default subdir
sudo rm -R ~/SEAsnake2/lost+found
## Copy previous SEAsnake data and results
## Note that if you used fuse for your data, you should unmount it, copy the SEAsnake directory, then re-establish fuse in the new SEAsnake2
cp -r ~/SEAsnake/ ~/SEAsnake2/
## Rerun SEAsnake
cd ~/SEAsnake2
nohup snakemake --snakefile Snakefile_step2 --cores $cores --rerun-incomplete >> log/SEAsnake_step2.log 2>&1
This is the most common error and results in error messages in the
log like Out of memory or std::bad_alloc. You
can use less RAM by reducing the number of --cores in the
snakemake call and re-running the step that failed with the addition of
--rerun-incomplete to fix any files that were currently
running when it crashed. For example,
## Decrease cores
cores=10
## Rerun SEAsnake
nohup snakemake --snakefile Snakefile_step2 --cores $cores --rerun-incomplete >> log/SEAsnake_step2.log 2>&1
SEAsnake is an open source workflow. We would love your feedback including error/bug reports and requests for additional features! Please let us known on our GitHub. We also welcome community code additions through pull requests!
Dill-McFarland KA, Benson B, Segnitz RM. 2022. SEAsnake: a pipeline for RNA-seq from fastq to counts. DOI: 10.5281/zenodo.5790287